What is the origin of the DNA sequence projected onto the Velociraptor?

Towards the end of Jurassic Park, there is a scene where a nucleotide sequence is projected onto a velociraptor. I originally watched this movie in 1994, and after recently re-watching it, I’m wondering what the source of the nucleotide sequence is. I have a suspicion that it is either totally random, or something taken from a textbook.

>velociraptor_line_8
TTATGTGTGTTAACTCTTGCCGAGATGCTAAGTAGCAAAGT
>velociraptor_line_9
GCGTAAGCCCAGAGAGATTCAATCGATCCTATTAA
>velociraptor_line_10
CTGCCAATAGCTATCTGCTACAGTATTTTACG
>velociraptor_line_11
CTATCTGTCGATCTCCGCACGTCC
>velociraptor_line_12
TAGTAAAGGGCAAATCTGA
>velociraptor_line_13
GCTCGCACTCTCTA

I did a GenBank BLASTn against one of the lines here and ended up with a 93% match to some mouse DNA, but these sequences are too short and can’t be interpreted from the projection with 100% accuracy, so it is difficult to get a good basis for comparison. I was expecting a 100% match to something, so I’m hoping there is more to the story. For reference, the release date of the movie was June 9, 1993, about a year after GenBank went online at NCBI, although the original database existed since 1982 and until 1993 most DNA sequences were published in print.