Science Fiction & Fantasy Asked by vallismortis on April 30, 2021
Towards the end of Jurassic Park, there is a scene where a nucleotide sequence is projected onto a velociraptor. I originally watched this movie in 1994, and after recently re-watching it, I’m wondering what the source of the nucleotide sequence is. I have a suspicion that it is either totally random, or something taken from a textbook.
>velociraptor_line_8
TTATGTGTGTTAACTCTTGCCGAGATGCTAAGTAGCAAAGT
>velociraptor_line_9
GCGTAAGCCCAGAGAGATTCAATCGATCCTATTAA
>velociraptor_line_10
CTGCCAATAGCTATCTGCTACAGTATTTTACG
>velociraptor_line_11
CTATCTGTCGATCTCCGCACGTCC
>velociraptor_line_12
TAGTAAAGGGCAAATCTGA
>velociraptor_line_13
GCTCGCACTCTCTA
I did a GenBank BLASTn against one of the lines here and ended up with a 93% match to some mouse DNA, but these sequences are too short and can’t be interpreted from the projection with 100% accuracy, so it is difficult to get a good basis for comparison. I was expecting a 100% match to something, so I’m hoping there is more to the story. For reference, the release date of the movie was June 9, 1993, about a year after GenBank went online at NCBI, although the original database existed since 1982 and until 1993 most DNA sequences were published in print.
Get help from others!
Recent Questions
Recent Answers
© 2024 TransWikia.com. All rights reserved. Sites we Love: PCI Database, UKBizDB, Menu Kuliner, Sharing RPP