Polymerase Cycle Assembly (PCA) is not working (Only primrs in EF Gel)

Question

Helllo All ?!
I am working trying to assemble dsDNA fragments (for further golden gate domestication) via polymerase cycle assembly (PCA). After designing the required oligonucleotides with overlap regions. (Image of the design provided below).
Using
NZYProof Green mastermix x2  25 uL
Inner Oligonucleotides 2 uL of 1 uM stock
Outer Oligonucleotides 2 uL of 100 uM stock
Initial denaturation 95 ºC 2 min
Denaturation 95 ºC 30 sec
Annealing 62 ºC 30 sec
Extension 72 ºC 30 sec
Repeated by 25 cycles
Final extension 72 ºC 2 min

After performing the following protocol (based on This one) with a high fidelity polymerase mastermix, the EF gel of PCR products only shows a single "band" corresponding with the oligonucleotides introduced in the reaction.  (Ignore the blurred EF gel, it was imaged quite a long time after running the gel).

Any idea of what could actually be going wrong? Should not I observe at least some faint higher molecular weight amplicons?
Thanks in advance for your answers!
Jorge.
UPDATE: Regarding the length of overlap regions, the design considers different overlap sequences length in order to achieve roughly the same Tm for all the overlaping regions. Tm of every overlap has been calculated using the online NEB Tm Calculator tool, and all of them are in the range of 61-63 °C (Considering a Q5 mastermix, which is the closest HiFi polymerase to the one we are currently using )
UPDATE2: After trying the PCA procedure with a "touchdown" approach (reducing annealing temperature gradually after 3 succesive cycles, most of the assemblies has started to show distinctive bands of the desired lenght in the EF Gel. Annealing is a crucial parameter for PCA.

Armand · Accepted Answer

I suspect mispriming due to annealing temp being too low compared to predicted melting temp of overlap regions. As the protocol in your link notes:

(3) Choose annealing temperature wisely. We recommend to use the same
as min_Tm by Primerize design, which is usually between 60-64 °C.
(4) Check PCR product on 4% agarose gel. If assembly is unsuccessful
with shorter mis-priming products, we suggest try raising the
annealing temperature to reduce mis-priming. Alternatively, splitting
the assembly into separate sub-pools (i.e. primer 1-4 and primer 5-6)
and do an additional round of full assembly (see below).

At first glance, the sample assembly in the linked protocol uses overlap regions of similar length (presumably of similar predicted melting temp as well), while your overlaps vary substantially in length (esp. red primer and bottom right gray primer).
Using the NEB Tm calculator page ( tmcalculator.neb.com/#!/main ), I got the following predicted Tms:
left gray/red primer overlap sequence (ctttccggtctgatgagt) Tm 61C
red/right gray primer overlap sequence (gtgaggacgaaacagcctctacaaataatt) Tm 68C
green/left gray primer overlap sequence (gctcgtataatgtgtggaag) Tm 60C
Based on the much higher Tm of the red/right gray overlap, I'd retry your reaction with annealing temps of 65C and 68C.

Polymerase Cycle Assembly (PCA) is not working (Only primrs in EF Gel)

One Answer

Add your own answers!

Ask a Question