How to remove sequences from a fasta file using a sequence ID list which contains a space within the id?

Install (pip) biopython if u don't have it.

from Bio import SeqIO
with open('/path/ids.txt', 'r') as fin:
    to_keep = set([])
    for line in fin:
        to_keep.add(line.strip().split(' ')[0])
with open('/path/output.fa', 'w') as fout:
    for record in SeqIO.parse('/path/sequences.fa','fasta'):
        if record.id in to_keep:
            SeqIO.write(record, fout, 'fasta')

I tend to do this using the FastaToTbl and TblToFasta scripts I have posted before. FastaToTbl will convert fastq sequences to single-line, tab-separated recors which makes them far easier to parse. Using these two scripts, you can do:

$ FastaToTbl file.fa | grep -vwf idList | TblToFasta 
>m64041_200717_231916/77/1941_50622 id=3115 
TGAGCCGCACCTCCTCAATCTGCAGCAGTTGAGGCCACTACCCTTCTGCTCAATGGTTCC
TGCAGACTTTATCATAGTCACTCACACTTGTCCATGAG
>m64041_200717_231916/162/0_6615 id=857 
CAGACTTTATCATAGTCACTCACACTTGTCCATGAGGCAGACTTTATCATAGTCACTCAC
ACTTG

The -v option will tell grep to return non-matching lines, and the -f option tells it to read the patterns to search for from a file. In this case, we give it the file with the IDs to skip (idList). The -w ensures we only find "whole word" matches, so that something like m64041_200717_231916/77/1941_50622 id=31151111 will not count as a match for m64041_200717_231916/77/1941_50622 id=31151111.

---

Another approach would be to just use awk directly:

$ awk '(NR==FNR){s[">"$0]++} (/^>/){ s[$0] ? a=0 : a=1}a' idList file.fa 
>m64041_200717_231916/77/1941_50622 id=3115
TGAGCCGCACCTCCTCAATCTGCAGCAGTTGAGGCCACTACCCTTCTGCTCAATGGTTCCTGCAGACTTTATCATAGTCACTCACACTTGTCCATGAG
>m64041_200717_231916/162/0_6615 id=857
CAGACTTTATCATAGTCACTCACACTTGTCCATGAGGCAGACTTTATCATAGTCACTCACACTTG

Here is the same awk script slightly expanded to make it easier to understand:

 awk '{
        if (NR==FNR){idsToSkip[">"$0]++} 
        else if (/^>/){ 
            if($0 in idsToSkip){
                wantThisId = 0
            }
            else{
                wantThisId = 1
            }
        }
        if(wantThisId == 1){
            print
        }
      }' idList file.fa