Does NCBI's blast API block my IP?

Question

I am trying to run a blatn command from both my laptop and within a google colab notebook. I am not sure why, but this command runs properly once and then, on the second execution, it gets stuck for hours without a reply.
Is it possible that NCBI blocks my IP? I've tried also to run web_blast.pl and this didn't work either.
biopython:
from Bio.Blast import NCBIWWW

fasta = '>seq0n'+'AACCACCTGACGGGCTCTGT'
blast_res = NCBIWWW.qblast('blastn', 'nt', fasta)
print(blast_res.read())

web_blast.pl command:
web_blast.pl blastn nt input.fa > blast.out
Note, if this is due to throttling by NCBI, I am not sure how do they expect people to query their web service if they block you after one call.

Mr_Z · Answer

You should check the User Guide:

The NCBI BLAST servers are a shared resource. We give priority to
interactive users. In order to ensure availability of the service to
the entire community, we may limit searches for some high volume
users. Interactive users of the NCBI webpages through a web browser
should not encounter problems. We will move searches of users who
submit more than 100 searches in a 24 hour period to a slower queue,
or, in extreme cases, will block the requests. To avoid problems, API
users should comply with the following guidelines:

Do not contact the server more often than once every 10 seconds.

Do not poll for any single RID more often than once a minute.

Use the URL parameter email and tool, so that the NCBI can contact you
if there is a problem.

Run scripts weekends or between 9 pm and 5 am Eastern time on weekdays
if more than 50 searches will be submitted.

Does NCBI's blast API block my IP?

One Answer

Add your own answers!

Ask a Question